Sample result
Human insulin's gene
A saved result, shown read-only. Sign in to run your own searches. A new account gets a free 30-day trial.
The search
- Query
- INS · 333 lettersATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
- Search
- DNA → Patent DNA · Automatic (BLAST)
- Set
- Public patent sequences: Patent DNA, snapshot 2026-11-05-c456f6bdba29
- Ran
- 2026-11-12
- Found
- 3,194 sequences, 1,584 publications, 1,066 families
Each query returns up to 5,000 sequences and 5 alignments per sequence. BLAST may miss matches. These results do not establish patentability.
Patents
1,584 publications in 1,066 families match these filters.
-
WO 0144455-A22001-06-21
Antisense oligonucleotides
AstraZeneca AB (SE)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 0171042-A22001-09-27
Detection kits, such as nucleic acid arrays, for detecting the expression of 10,000 or more Drosophila genes and uses thereof
PE Corporation (NY) (US)
Query Match 6.9%Identity 92.9%
Best alignment
Query 7 to 34, hit 1150 to 1177. Positions start at 1 and include both ends.
Query 7 CTGTGGATGCGCCTCCTGCCCCTGCTGG 34 ||||||||| || ||||||||||||||| Hit 1150 CTGTGGATGAGCATCCTGCCCCTGCTGG 117726 of 28 identical, no gaps.
-
WO 0194629-A22001-12-13
Cancer gene determination and therapeutic screening using signature gene sets
Avalon Pharmaceuticals (US)
Query Match 6.9%Identity 92.6%Family of 2
Best alignment and family
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
Family of 2
Grouped by the same title and applicant. No priority claim is on record.
- WO 0194629-A22001-12-13
- JP 2004509612-A2004-04-02
-
WO 0210217-A22002-02-07
Endothelial cell expression patterns
The Johns Hopkins University (US)
Query Match 6.9%Identity 88.6%Family of 8
Best alignment and family
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
Family of 8
Grouped by a shared priority claim, US 60/282850.
- WO 0210217-A22002-02-07
- JP 2004527210-A2004-09-09
- JP 2004533825-A2004-11-11
- US 7358351-A2008-04-15
- US 7393932-A2008-07-01
- US 7402660-A2008-07-22
- JP 2013100284-A2013-05-23
- JP 2015192672-A2015-11-05
-
WO 0229103-A22002-04-11
Gene expression profiles in liver cancer
GENE LOGIC INC (US)
Query Match 6.9%Identity 88.6%Family of 2
Best alignment and family
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
Family of 2
Grouped by the same title and applicant. No priority claim is on record.
- WO 0229103-A22002-04-11
- US 6974667-A2005-12-13
-
JP 2002515241-A2002-05-28
Amino acid-modified polypeptide
UNITED STATES SURGICAL CORP
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 650 to 684. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 650 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 68431 of 35 identical, 1 gap.
-
KR 1020027007591-A2002-06-14
ANTISENSE OLIGONUCLEOTIDES
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 03020757-A22003-03-13
Novel genetic products obtained from Ashbya gossypii, which are associated with transcription mechanisms, RNA processing and/or translation
Basf Aktiengesellschaft (DE)
Query Match 6.9%Identity 90.0%Family of 2
Best alignment and family
Query 18 to 51, hit 364 to 398. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 ||| ||| |||||||||| ||||||||||| |||| Hit 364 CCTGCTGGCCCTGCTGGCCCTGCTGGCCCTGCTGG 39831 of 35 identical, 1 gap.
Family of 2
Grouped by the same title and applicant. No priority claim is on record.
- WO 03020757-A22003-03-13
- JP 2005506065-A2005-03-03
-
JP 2003516752-A2003-05-20
Antisense oligonucleotide for inhibiting the expression of type I procollagen
ASTRAZENECA AB
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
US 6617431-A2003-09-09
Recombinant collagen and derived proteins produced by plants, methods for obtaining them and uses
Meristem Therapeutics S.A.
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1133 to 1167. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1133 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 116731 of 35 identical, 1 gap.
-
JP 2003310272-A2003-11-05
The screening methods for vasodilators based on the expression of vasodilator-responsive genes
Toshio Tanaka,Asahi Chemical Industry Co Ltd, Sumitomo Pharmaceuticals Co Ltd
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
KR 1020047003137-A2004-03-02
Novel polynucleotides for modulation of transcription/translation
Query Match 6.9%Identity 90.0%
Best alignment
Query 18 to 51, hit 364 to 398. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 ||| ||| |||||||||| ||||||||||| |||| Hit 364 CCTGCTGGCCCTGCTGGCCCTGCTGGCCCTGCTGG 39831 of 35 identical, 1 gap.
-
US 6703491-A2004-03-09
Drosophila sequences
Exelixis, Inc.
Query Match 6.9%Identity 92.9%
Best alignment
Query 7 to 34, hit 881 to 854. Positions start at 1 and include both ends.
Query 7 CTGTGGATGCGCCTCCTGCCCCTGCTGG 34 ||||||||| || ||||||||||||||| Hit 881 CTGTGGATGAGCATCCTGCCCCTGCTGG 85426 of 28 identical, no gaps.
-
EP 1439393-A22004-07-21
Detection methods using TIMP 1 for colon cancer diagnosis
Bayer Healthcare LLC (US)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2004112829-A22004-12-29
No title supplied
GENENTECH, INC. (US)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
EP 1522594-A22005-04-13
Methods and kits for investigating cancer
Bayer HealthCare AG (DE)
Query Match 6.9%Identity 88.6%Family of 4
Best alignment and family
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
Family of 4
Grouped by the same title and applicant. No priority claim is on record.
- EP 1522594-A22005-04-13
- WO 2005040414-A12005-05-06
- JP 2007512804-A2007-05-24
- EP 1892306-A2008-02-27
-
KR 1020050038144-A2005-05-06
Prognostic for hematological malignancy
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
US 6896881-A2005-05-24
Therapeutic methods and compositions using viruses of the recombinant paramyxoviridae family
Mayo Foundation for Medical Education and Research
Query Match 6.9%Identity 100.0%
Best alignment
Query 169 to 191, hit 37 to 59. Positions start at 1 and include both ends.
Query 169 GAGGCAGAGGACCTGCAGGTGGG 191 ||||||||||||||||||||||| Hit 37 GAGGCAGAGGACCTGCAGGTGGG 5923 of 23 identical, no gaps.
-
US 6927287-A2005-08-09
Nucleic acid encoding extracellular matrix protein or fragment thereof
United States Surgical Corporation
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 659 to 693. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 659 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 69331 of 35 identical, 1 gap.
-
JP 2005523688-A2005-08-11
IDENTIFICATION OF POLYNUCLEOTIDES AND POLYPEPTIDE FOR PREDICTING ACTIVITY OF COMPOUNDS THAT INTERACT WITH PROTEIN TYROSINE KINASES AND/OR PROTEIN TYROSINE KINASE PATHWAYS
BRISTOL-MYERS SQUIBB COMPANY
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2005083125-A22005-09-09
Surrogate markers of neuropathic pain
Biogen Idec MA, Inc. (US)
Query Match 6.9%Identity 88.6%Family of 4
Best alignment and family
Query 18 to 51, hit 1239 to 1273. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1239 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127331 of 35 identical, 1 gap.
Family of 4
Grouped by a shared priority claim, US 10/784004.
- WO 2005083125-A22005-09-09
- JP 2007536913-A2007-12-20
- JP 2008188014-A2008-08-21
- EP 1980628-A22008-10-15
-
US 6958223-A2005-10-25
Methods for producing extracellular matrix proteins
United States Surgical Corporation
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 659 to 693. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 659 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 69331 of 35 identical, 1 gap.
-
KR 1020057022428-A2005-11-23
Compositions and Methods for the Diagnosis and Treatment of Tumors of Glial Origin
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
JP 2005333987-A2005-12-08
PROGNOSTIC FOR HEMATOLOGICAL MALIGNANCY
Veridex LLC
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
EP 1612281-A22006-01-04
Methods for assessing patients with acute myeloid leukemia
Veridex, LLC (US)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2006019037-A2006-02-23
Method for judging hepatic fibrogenesis stage
Ajinomoto Co Inc
Query Match 6.9%Identity 88.6%Family of 2
Best alignment and family
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
Family of 2
Grouped by a shared priority claim, JP 200 4-236743.
- WO 2006019037-A2006-02-23
- JP 2007315752-A2007-12-06
-
US 7033831-A2006-04-25
Islet cells from human embryonic stem cells
Geron Corporation
Query Match 6.9%Identity 100.0%
Best alignment
Query 93 to 115, hit 1 to 23. Positions start at 1 and include both ends.
Query 93 CGGCTCACACCTGGTGGAAGCTC 115 ||||||||||||||||||||||| Hit 1 CGGCTCACACCTGGTGGAAGCTC 2323 of 23 identical, no gaps.
-
WO 2006044842-A22006-04-27
Pancreatic islet beta-cell-like macrophages and methods to produce them
The University of Chicago (US)
Query Match 6.9%Identity 100.0%
Best alignment
Query 1 to 23, hit 1 to 23. Positions start at 1 and include both ends.
Query 1 ATGGCCCTGTGGATGCGCCTCCT 23 ||||||||||||||||||||||| Hit 1 ATGGCCCTGTGGATGCGCCTCCT 2323 of 23 identical, no gaps.
-
JP 2006516089-A2006-06-22
COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TREATMENT OF TUMOR
THOMAS D WU,ZEMIN ZHANG,YAN ZHOU
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
JP 2006516192-A2006-06-29
COMPOSITIONS AND METHODS FOR THE DIAGNOSIS AND TREATMENT OF TUMOR
THOMAS WU,YAN ZHOU
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
EP 1698695-A22006-09-06
No title supplied
Nath, Rahul Kumar, M.D. (US)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2006106970-A2006-10-12
Method for preparing of protein having triple helix structure
FUSO PHARMACEUTICAL INDUSTRIES LTD,OSAKA PREFECTURAL GOVERNMENT
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1123 to 1157. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1123 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 115731 of 35 identical, 1 gap.
-
US 7125663-A2006-10-24
Genes, compositions, kits and methods for identification, assessment, prevention, and therapy of cervical cancer
Millenium Pharmaceuticals, Inc.
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
EP 1716227-A22006-11-02
METHODS OF IDENTIFYING PUTATIVE GENE PRODUCTS BY INTERSPECIES SEQUENCE COMPARISON AND BIOMOLECULAR SEQUENCES UNCOVERED THEREBY
COMPUGEN LTD
Query Match 6.9%Identity 90.3%
Best alignment
Query 18 to 51, hit 1279 to 1313. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1279 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 131331 of 35 identical, 1 gap.
-
US 7173122-A2007-02-06
Antisense oligonucleotides to type I procollagen
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2007039255-A12007-04-12
Tumor angiogenesis associated genes and a method for their identification
Universiteit Maastricht (NL)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
JP 2007516232-A2007-06-21
Compositions and Methods for the Diagnosis and Treatment of Tumors of Glial Origin
GENENTECH INC
Query Match 6.9%Identity 88.6%Family of 2
Best alignment and family
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
Family of 2
Grouped by the same title and applicant. No priority claim is on record.
- JP 2007516232-A2007-06-21
- US 8008004-B22011-08-30
-
EP 1806400-A22007-07-11
Inactivation method
Fermentas UAB (LT)
Query Match 6.9%Identity 100.0%
Best alignment
Query 98 to 120, hit 23 to 1. Positions start at 1 and include both ends.
Query 98 CACACCTGGTGGAAGCTCTCTAC 120 ||||||||||||||||||||||| Hit 23 CACACCTGGTGGAAGCTCTCTAC 123 of 23 identical, no gaps.
-
EP 1838351-A22007-10-03
Therapy inhalation involving antisense oligonucleotides for treating idiopathic pulmonary fibrosis
NATH RAHUL KUMAR M D
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
US 7326572-A2008-02-05
Endoderm cells from human embryonic stem cells
Geron Corporation
Query Match 6.9%Identity 100.0%
Best alignment
Query 93 to 115, hit 1 to 23. Positions start at 1 and include both ends.
Query 93 CGGCTCACACCTGGTGGAAGCTC 115 ||||||||||||||||||||||| Hit 1 CGGCTCACACCTGGTGGAAGCTC 2323 of 23 identical, no gaps.
-
JP 2008118915-A2008-05-29
oncogene for gastric cancer and its use for drug discovery and diagnostic agent
National Cancer Center,Kazuto Nishio,Tokuzo Arao
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1249 to 1283. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1249 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 128331 of 35 identical, 1 gap.
-
US 7396823-A2008-07-08
Therapy inhalation involving antisense oligonucleotides for treating idiopathic pulmonary fibrosis
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2008081435-A22008-07-10
Methods and kits for predicting prognosis of multiple sclerosis
Tel HaShomer Medical Research Infrastructure and Services Ltd. (IL)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
JP 2008545400-A2008-12-18
THYROID FINE NEEDLE ASPIRATION MOLECULAR ASSAY
VERIDEX LLC
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2008154098-A22008-12-18
Reagents and methods for mirna expression analysis and identification of cancer biomarkers
Wisconsin Alumni Research Foundation (US)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1249 to 1283. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1249 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 128331 of 35 identical, 1 gap.
-
JP 2009505658-A2009-02-12
BIOMARKERS AND METHODS FOR DETERMINING SENSITIVITY TO EPIDERMAL GROWTH FACTOR RECEPTOR MODULATORS
Bristol-Myers Squibb Company
Query Match 6.9%Identity 88.6%Family of 2
Best alignment and family
Query 18 to 51, hit 1249 to 1283. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1249 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 128331 of 35 identical, 1 gap.
Family of 2
Grouped by the same title and applicant. No priority claim is on record.
- JP 2009505658-A2009-02-12
- US 8129114-B22012-03-06
-
EP 2025752-A22009-02-18
Antisense oligonucleotides for the inhibition of expression of type I procollagen
Nath, Rahul Kumar (US)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2009053985-A12009-04-30
Methods of processing recombinant procollagen
Collplant Ltd. (IL)
Query Match 6.9%Identity 88.6%Family of 2
Best alignment and family
Query 18 to 51, hit 1249 to 1283. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1249 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 128331 of 35 identical, 1 gap.
Family of 2
Grouped by the same title and applicant. No priority claim is on record.
- WO 2009053985-A12009-04-30
- US 8759487-B22014-06-24
-
EP 2057465-A22009-05-13
Organ-specific proteins and methods of their use
HOMESTEAD CLINICAL CORP
Query Match 6.9%Identity 92.3%
Best alignment
Query 18 to 51, hit 1242 to 1276. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1242 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 127631 of 35 identical, 1 gap.
-
WO 2009093213-A22009-07-30
Method for predicting and diagnosing brain tumor
Universite de Lausanne (CH)
Query Match 6.9%Identity 88.6%
Best alignment
Query 18 to 51, hit 1249 to 1283. Positions start at 1 and include both ends.
Query 18 CCTCCTGCCCCTGCTGGCGCTGCTGGCCCT-CTGG 51 || |||| ||||||||| |||||||||||| |||| Hit 1249 CCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGG 128331 of 35 identical, 1 gap.